facebook twetter twetter twetter
الرد على نظرية التطور - الادلة العلمية للرد على نظرية التطور صور و روابط علمية - صفحة 2 - منتديات الهدى
  • تطبيق البحث في القرآن الكريم مع التصفح وتفسير الآيات القرآنية المتشابهة بأسلوب واضح ومفهوم للجميع من كتاب تفسير المتشابه من القرآن.
  • اثبات عدم وجود ناسخ ومنسوخ في القران الكريم
  • وقت الافطار الحقيقي في شهر رمضان على ضوء القران الكريم
+ إنشاء موضوع جديد
صفحة 2 من 6 الأولىالأولى 1234 ... الأخيرةالأخيرة
النتائج 19 إلى 36 من 96

المشاهدات : 34771 الردود: 95 الموضوع: الرد على نظرية التطور - الادلة العلمية للرد على نظرية التطور صور و روابط علمية

  1. #19
    مشرف عام
    رقم العضوية : 36
    تاريخ التسجيل : Oct 2010
    المشاركات : 1,349
    التقييم: 125
    الجنـس : ذكر
    ويتم تركيب هذه الحروف الأربعة - أو القواعد النيتروجينية الأربعة a.c.t.g - على جانبي لولب الشريط الوراثي (والذي خلقه الله بهذا الشكل المزدوج لكي يتم فك كل جانب منه لنسخ معلوماته ثم وصله مِن جديد !) بحيث كل حرفين أو زوجين متقابلين منها مُرتبطان بروابط هيدروجينية ويُسمى نيوكليتيدة : والروابط إما تكون ( a معt ) برابطتين هيدروجينيتين أو (c مع g ) بثلاث روابط هيدروجينية وكما في الصورة التبسيطية التالية :

    الصور المرفقة الصور المرفقة  
    توقيع عبد الرحمن العجمي

  2. #20
    مشرف عام
    رقم العضوية : 36
    تاريخ التسجيل : Oct 2010
    المشاركات : 1,349
    التقييم: 125
    الجنـس : ذكر
    وفي الشريط النووي الوراثي للإنسان مثلًا - وداخل كروموسومات نواة الخلية الواحدة - 3 مليار نيوكليتيدة !!.. أي : 3 مليار حرف (والمليار ألف مليون) وكل 3 حروف منها تكون حمض أميني واحد (أي كلمة واحدة وتسمى كودون) , حيث لدينا 20 نوع مِن الأحماض الأمينية التي تكوين عشرات البروتينات التي يستخدمها الجسم في كل شيء في حياته ! والآن ... كيف يتم قراءة هذه الشيفرات (الكودونات) والحروف والكلمات لتكوين الأحماض الأمينية : بهدف تجميع البروتينات التي تدخل في كل أعمال ووظائف الجسم في النهاية ؟ وخصوصًا وأننا أمام سلاسل طويلة جدًا غير مفهومة المعنى إلا لمَن هداها الله تعالى لوظيفتها في فك شيفرتها ؟
    atttccgtacgtgacgtacgacgtaacttgcatgcattaagtgtacagta ccgtac

    < ولذلك قلنا أن وجود هذه الشيفرة نفسه والمعاني الدالة عليها يكفي وحده لهدم فكرة التطور الصدفي العشوائي ! إذ أنه يتعارض مع أبسط مفاهيم علوم الفيزياء والكيمياء وهو أن ذرات المواد لا حرية اختيار لها ولا عقل ! فمِن أين جاءت بكل هذا الترتيب والنظام واللغة وكما سنتابع الآن ؟ >

    نقول أنه تتم عملية تكوين البروتينات بصورة معقدة جدًا يكفينا الآن أن نعرف خطواتها كالتالي :

    1)) يتم تمرير إنزيم (هيليكيز) على الشريط اللولبي المزدوج لفك كل شق منه في منطقة معينة (مَن الذي جعل الإنزيم يفهم هذه المهمة ؟!)
    < والإنزيمات هي نوع مِن أنواع البروتينات . ولذلك قلنا أن البروتينات تدخل في كل أعمال ووظائف الجسم >

    2)) بعد كسر الروابط الهيدروجينية وفصل كل جانب للشريط على حدة في منطقة معينة : تأتي بروتينات صغيرة لترتبط بكل شريط على حدة حتى لا يلتحم مِن جديد مع الآخر مِن قبل أن تتم عملية نسخ الجزء المطلوب ! (مَن الذي أوحى لهذه البروتينات بهذه المهمة ؟ ولاحظوا اننا نتحدث في عالم مِن النانو متر ! أي ألف مِن المليون مِن المتر !)

    3)) يأتي حمض نووي آخر (وهو rna) لنسخ الجزء المقابل لأحد شقي الشريط المفكوك , وذلك لأن كل حرف معروف لزومًا الحرف الذي سيقابله كما قلنا ( a معt ) و (c مع g ) .. والـ rna له ثلاثة أنواع ستدخل كلها في عملية نسخ وتكوين الأحماض الأمينية لتكوين البروتينات كالتالي :
    الصور المرفقة الصور المرفقة  
    توقيع عبد الرحمن العجمي

  3. #21
    مشرف عام
    رقم العضوية : 36
    تاريخ التسجيل : Oct 2010
    المشاركات : 1,349
    التقييم: 125
    الجنـس : ذكر
    وهذه صورة فك تلافيف الشريطين اللولبيين لنسخ جزء معين منهما عن طريق إنزيم بلمرة RNA لعمل المرسال الحامل للنسخة المقابلة للشيفرات (وهو mRNA) :

    الصور المرفقة الصور المرفقة  
    توقيع عبد الرحمن العجمي

  4. #22
    مشرف عام
    رقم العضوية : 36
    تاريخ التسجيل : Oct 2010
    المشاركات : 1,349
    التقييم: 125
    الجنـس : ذكر
    يتم خروج المرسال mRNA مِن نواة الخلية عبر الثقوب النووية إلى الريبوسوم الذي في سيتوبلازم الخلية ليتم ترجمته هناك (مَن الذي عرفه طريق الخروج ؟! ولماذا ؟! مَن الذي يقوده ويأخذ بناصيته ويهديه ؟!)
    5)) يقوم نوع آخر مِن الـ RNA وهو الناقل أو tRNA بحمل كل
    3 حروف (وهي الكودون أو الكلمة كما قلنا) : إلى الريبوسوم rRNA الذي سيقوم حاملًا معه في كل مرة الحمض الأميني المقابل لكل كودون ليستجمع مع كل حمض عديد الببتيد الذي سيكون البروتين المقصود في النهاية !!!!..
    الصور المرفقة الصور المرفقة  
    توقيع عبد الرحمن العجمي

  5. #23
    مشرف عام
    رقم العضوية : 36
    تاريخ التسجيل : Oct 2010
    المشاركات : 1,349
    التقييم: 125
    الجنـس : ذكر
    وهذه صورة توضح العملية كلها :

    الصور المرفقة الصور المرفقة  
    توقيع عبد الرحمن العجمي

  6. #24
    مشرف عام
    رقم العضوية : 36
    تاريخ التسجيل : Oct 2010
    المشاركات : 1,349
    التقييم: 125
    الجنـس : ذكر
    وبمثل هذا التعقيد والغائية التي تستحيل على الصدفة والعشوائية والتطور المزعوم - هناك عشرات المعلومات التفصيلية التي لم نذكرها لأنها تناسب المختصين - نسأل :
    هل مِن الغريب بعد كل ذلك أن يعلن الملاحدون الصادقون مع أنفسهم تراجعهم عن نظرتهم للحياة والتطور الدارويني الصدفي العشوائي وكما فعل السير (أنتوني فلو) Antony Flew ليعلن عن وجود إله وهو في هذا السن الكبير ! وبعدما عاش قرابة الـ 50 سنة داعيًا مِن أعتى دعاة الإلحاد ليعلن عن تراجعه عن إلحاده ويصدر كتابه الرائع : هناك إله ؟ There is a God


    والذي مِن أقواله فيه :
    " لقد أثبتت أبحاث علماء الأحياء في مجال الحمض النووي الوراثي , ومع التعقيدات شبه المستحيلة المتعلقة بالترتيبات اللازمة لإيجاد (الحياة) أثبتت أنه : لابد حتماً مِن وجود قوة خارقة وراءها " !!...

    ويقول أيضًا :
    " لقد أصبح مِن الصعوبة البالغة مجرد البدء في التفكير في إيجاد نظرية تنادي بالمذهب الطبيعي لعملية نمو أو تطور ذلك الكائن الحي : والمبني على مبدأ التوالد والتكاثر " !!!!..

    ومدى الحيرة التي تصيب الملحدين والتطوريين الصادقين مع أنفسهم هنا : هي بسبب النظام الدقيق (المُعد مُسبقًا كما يلاحظه كل ذي عقل) لعمل الخلية الحية المعقد والتي تشبه المدينة الكاملة بداخلها - حتى مع وجود أجسام الميتوكوندريا كمصانع للطاقة ! - ومع وجود نواة الخلية الحاملة للكرومسومات والتي تحتوي شيفرة تصنيع كل تفصيلة في جسم الإنسان مِن إنزيمات لهرمونات لبروتينات وتقنيات النسخ الدقيقة وقراءة الشيفرات - حتى أنه يوجد نظام لتصحيح أي أخطاء ناتجة عن النسخ ! DNA repair - فمَن ذا الذي يدعي ظهور كل ذلك صدفة أو عشوائية وبعقل مَن تم تنظيم كل ذلك ؟!!!..



    الصور المرفقة الصور المرفقة  
    توقيع عبد الرحمن العجمي

  7. #25
    مشرف عام
    رقم العضوية : 36
    تاريخ التسجيل : Oct 2010
    المشاركات : 1,349
    التقييم: 125
    الجنـس : ذكر
    بل حتى الأوصاف التي قد يستسهل البعض قراءتها هنا : لن يُدرك مدى تعقيدها إلا العالمون بهذه المسائل ! فكل إنزيم وكل بروتين مثلًا , له تركيب ثلاثي الأبعاد مُعقد مِن الذرات : والذي لو لم يكن بالصورة التي هو عليها (أي لو اتخذ أشكالًا أخرى لترتيب ذراته في الثلاثة أبعاد) لما وافق ذلك مهمته في الارتباطات الوظيفية مع غيره مِن الأجسام في الخلية ونواتها ومركباتها !!!!..


    صورة توضيحية ثلاثية الأبعاد لبروتين الميجلوبين myoglobin كمثال .

    وهنا نأتي للسؤال القاصم - والمعتاد - وهو : ما الذي ظهر أولًا - لو كان الأمر بالتطور حقًا - :
    الشريط النووي الوراثي وحروفه التي تكون الأحماض الأمينية التي تكون البروتينات والإنزيمات ؟
    أم البروتينات والإنزيمات التي تعمل أصلًا على تكوين الشريط النووي الوراثي ونسخه وتضاعفه ؟

    وللسؤال القاصم أيضًا :
    كيف ظهر بالصدفة والعشوائية : نظام يعمل على مراجعة نسخ الشيفرات وتصحيح أي أخطاء في حروفها ؟
    كيف فهم مثل هذه الوظيفة أصلًا ؟!!.. وهل الذرات عاقلة لكي ننسب إليها هذه الأشياء ؟!

    وآخرًا وليس أخيرًا - لان الأسئلة القاصمة كثيرة وإنما نختصر اختصارًا لعدم التطويل - :
    كيف فرقت الخلايا بين نسخ كل الخلايا الجسدية وتضاعف كرومسوماتها الـ 23 زوج (حيث تقوم كل خلية بنسخ محتواها الوراثي إلى خليتين) : وبين أن يتم فصل نصف هذا العدد فقط في الخلايا الجنسية في الخصيتين في الذكر والمبيضين في الأنثى : حتى إذا اجتمع النصف مِن هنا والنصف مِن هنا عند الزواج : عادت الخلايا الجسدية لعددها الكامل مِن جديد بعد عملية خلط الصفات بين الذكر والأنثى ؟!!..
    الصور المرفقة الصور المرفقة  
    توقيع عبد الرحمن العجمي

  8. #26
    مشرف عام
    رقم العضوية : 36
    تاريخ التسجيل : Oct 2010
    المشاركات : 1,349
    التقييم: 125
    الجنـس : ذكر
    وخلاصة هذا الفصل - الذي لم نشأ التطويل فيه - ....
    هو أنه قد فات داروين للأسف تفاصيل إعجازية كثيرة عما يجري داخل خلية الإنسان ومادته الوراثية مِن تعقيد ونظام وغائية لم يكن يعلم عنها داروين شيئا ! وهذا لا يعني أننا نلتمس له العذر ! وذلك لأنه حتى لو لم نع
    رف تلك التفاصيل المبهرة التي داخل الخلية : فإن جسم الإنسان - وكل كائن حي - يحتوي على مئات الشواهد والأدلة على أنه له خالق مُدبر حكيم وعليم ! فالإنسان مثلًا مُكون مِن بليونات الخلايا والسؤال : كيف مِن بين كل هذه البليونات نرى أن لكل واحد مِنا عقل واحد فقط يفكر به ويتخذ به قراراته واختياراته ؟! كيف يشعر الواحد مِنا بأنه (شخص متفرد) يقود هذا الجسد وليس بليونات الخلايا ؟! وأما الأعجب والأعجب : فهو أنه هناك مليارات العمليات الحيوية والتنظيمية الدقيقة جدًا لدرجة لا نتخيلها والتي تتم في أجسادنا في كل لحظة : ونحن لا ندري عنها أي شيء ! في الشرب والأكل والهضم والإخراج والتكاثر والتفكير والحركة والتنفس وتبادل الدم وعمل الهرمونات عند الاستثارة أو الغضب أو المجهود الزائد أو تنقية الدم في الكليتين وغير ذلك الكثير جدًا مما يستحيل حصره إلا على خالقه عز وجل ؟! فمَن الذي هيأ كل ذلك للإنسان بل ولكل كائن حي ؟!

    والحمد لله رب العالمين .
    توقيع عبد الرحمن العجمي

  9. #27
    مشرف عام
    رقم العضوية : 36
    تاريخ التسجيل : Oct 2010
    المشاركات : 1,349
    التقييم: 125
    الجنـس : ذكر
    الفصل_الثالث_استحالة_صدفة_البروتين_والخلية

    كان لزامًا علينا قبل التطرق إلى استحالة تكون البروتين الواحد صدفة أو الخلية الواحدة عشوائيًا أن نفرد شرحًا مبسطا كما في الفصل الماضي , حيث عرفنا فيه كيف أن البروتينات هي العنصر الفاعل في كل خلايا الجسم - بل قد تمثل البروتينات وحدها ثلثي مكونات الخلية الحية ! - ولذلك .. فهدف الحمض النووي الوراثي الـ dna الموجود في كروموسومات كل خلايا الجسم هو تحويل شيفراته بواسطة rna إلى مختلف أنواع البروتينات المطلوبة بأنواعها الثلاثة : بروتينات تركيبية (المختصة بصفات الكائن الحي وأعضائه) , بروتينات إنزيمية (وهي التي تكون الإنزيمات المنظمة لصفات الأيض والعمل) , بروتينات هرمونية (وهي المختصة بالتحكم في نمو الكائن وتطور وكبر أعضائه إلى مرحلة البلوغ) .
    الصور المرفقة الصور المرفقة  
    توقيع عبد الرحمن العجمي

  10. #28
    مشرف عام
    رقم العضوية : 36
    تاريخ التسجيل : Oct 2010
    المشاركات : 1,349
    التقييم: 125
    الجنـس : ذكر
    وأما تلخيص ذلك - شحذا للذاكرة - : فهو أن الحمض النووي يحتوي على جينات تكوين بروتينات الكائن الحي . والجين قد يتكون من مئات أو آلاف القواعد نيتروجينية (النيوكليدات) والتي يتوقف عددها حسب كبر أو صغر البروتين المطلوب , وتلك القواعد النتروجينية هي الأربعة المعروفة (c - g - t - a) , وهي الحروف التي تكون كل ثلاثة منها ما يعرف بالـ (كودون) في حمض rna الناقل , وهو الكلمة التي ستختص بتكوين حمض أميني (لأن كل حمض أميني واحد يتكون من ثلاثة أحرف أي ثلاث قواعد نتروجينية) مع التنويه لاستبدال حرف/ أو قاعدة t الثايمين بـ u اليوراسيل - وهذا من أهم الفوارق بين الـ dna و rna - , ثم في الريبوسوم خارج نواة الخلية يتم ترجمة هذه الكودونات واستدعاء الأحماض الأمينية الخاصة بها لربطها جميعا لتكوين الربوتين المطلوب بالروابط الببتيدية - معلوم أنه هناك 20 نوع من الأحماض الأمينية - :


    حيث يوضح الجدول أسماء وتراكيب الـ 20 نوع من الأحماض الأمينية ..

    الصور المرفقة الصور المرفقة  
    توقيع عبد الرحمن العجمي

  11. #29
    مشرف عام
    رقم العضوية : 36
    تاريخ التسجيل : Oct 2010
    المشاركات : 1,349
    التقييم: 125
    الجنـس : ذكر
    وأما في الرسمة التوضيحية التالية : فنرى كل دائرة صغيرة تمثل ترتيب معين للحمض الأميني في تركيب سلسلة البروتين التي قد تطول أو تقصر حسب نوعه , ثم تم تكبير أربع دوائر صغيرة منها كمثال وكما هو موضح على يمين الرسمة , ثم تكبير أحدها - وهي الدائرة الكبرى والمكتوب أسفلها حمض أميني - والبروتين متوسط الطول قد يحتوي على 500 حمض أميني .


    والآن .. كيف نحسب احتمالات تكون بروتين واحد - متوسط الطول - صدفة ؟

    الصور المرفقة الصور المرفقة  
    توقيع عبد الرحمن العجمي

  12. #30
    مشرف عام
    رقم العضوية : 36
    تاريخ التسجيل : Oct 2010
    المشاركات : 1,349
    التقييم: 125
    الجنـس : ذكر
    توجد ثلاثة شروط لتكوين بروتين مفيد :
    (1) أن تكون جميع الأحماض الأمينية في سلسلة البروتين هي من النوع الصحيح وبالتتابع الصحيح.
    (2) أن تكون جميع الأحماض الأمينية في السلسلة عسراء (أي يسارية الرابطة وليست يمينية) .

    (3) أن تكون جميع هذه الأحماض الأمينية متحدة فيما بينها من خلال تكوين ترابط كيميائي محدد يسمى "ترابط الببتايد".

    فهذه الشروط الثلاثة الأساسية يجب أن تتوافر معًا لتكوين البروتين .. ولحساب احتمالية تكوين ذلك البروتين بمحض الصدفة : فسنضرب احتمالات الثلاثة شروط السابق ذكرها , وسوف نأخذ بروتين متوسط كمثال - يتكون من 500 حمض أميني - :

    (1)
    احتمالية أن تكون الأحماض الأمينية موجودة بالتتابع الصحيح :
    بما أننا لدينا 20 حمض أميني , وأن البروتين المثال الذي معنا فيه 500 حمض أميني :
    إذن احتمالية أن يتم اختيار كل الأحماض الخمسمائة بالشكل والترتيب الصحيح هو =
    (1/20) أس 500 = 1/(10 أس 650) ..........!

    (2)
    احتمالية أن تكون الأحماض الأمينية عسراء - أي يسارية الرابطة كلها لأن هذا شرط ترابطها في اليربوسوم في سلسلة البروتين - : هذه الاحتمالية هي واحد من اثنين لكل حمض أميني (لأنه إما يميني أو يساري) = 2/1
    وعلى هذا تكون احتمالية جميع الأحماض الأمينية عسراء = (1/2) أس 500 = 1/(10 أس 150) !

    (3)
    احتمالية اتحاد الأحماض الأمينية بترابط الببتايد :
    وهذه الاحتمالية مثل السابقة : هي واحد من اثنين = 1/2.
    إذن احتمالية اتحاد جميع الأحماض الأمينية بترابطات ببتيدية =
    (1/2) أس 499 = 1/(10 أس 150) !

    وهكذا تكون المحصلة النهائية للاحتمال =
    1/(10 أس 650) × 1/(10 أس 150) × 1/(10 أس 150) =
    1/(10 أس 950) !!!!!!!!!!!!!!!!!..

    ولاحظوا أن الرقم 10 أس 950 يعني واحد وأمامه 950 صفر !!!!..
    أو ما يساوي الرقم مليار (أي ألف مليون 1000,000,000 مضروبا في نفسه أكثر من 105 مرة) !..

    وهو رقم مذهل ..! ولو استخدمنا مليارات المليارات من الكمبيوترات بسرعات مذهلة لمحاكاة هذا الاحتمال : فلن يكفيها عمر الكون كلّه (حتى ولو افترضناه 15 مليار سنة ولا حتى أضعاف أضعاف أضعافه) لإنتاج بروتين واحد بالصدفة !!.. حيث لو افترضنا أنه تجري محاولة واحدة كل ثانية من أول الكون : فإن كل عمر الكون لا يساوي عشر معشار ذلك الرقم : وحتى لو افترضنا أن كل محاولة تجري بسرعة الضوء !!! بل ولو مثلنا كل احتمال منهم على جزيء واحد من المفترض وجودهم في الكون كله (حتى البروتونوات والنيترونات في ذرات الكون) : فلن تكفي ! بل وحتى المستحيل الرياضي نفسه (أي ما يساوي احتمال صفر عند العلماء) فهو ما يساوي 1 إلى 10 أس 50 !!.. فأين هذا كله من احتمالية 1 إلى 10 أس 950 ؟!!
    توقيع عبد الرحمن العجمي

  13. #31
    مشرف عام
    رقم العضوية : 36
    تاريخ التسجيل : Oct 2010
    المشاركات : 1,349
    التقييم: 125
    الجنـس : ذكر
    لقد سببت مثل هذه الأرقام العلمية الصريحة صدمة عنيفة لعلماء الملاحدة أنفسهم ! - وقد مر بنا من قبل اعترافات الملحد أنتوني فلو في آخر حياته بحتمية وجود إله أمام هذه الصدمات القاتلة للصدفة داخل الخلية الحية وحمضها النووي - , ومن أشهر أولئك أيضًا هو العالم فريد هويل Fred Hoyle والذي قال :
    " أن احتمالية ظهور بروتين وظيفي واحد بالصدفة من تكوينات الأحماض الأمينية : هي مثل أن تملأ المجموعة الشمسية برجال عميان يحاولون الوصول إلى حل مكعب الروبيك في لحظة واحدة " !

    المصدر :
    Genetic Algorithms and Evolutionary Computation at the talkorigins Archive


    ولاحظوا بعد كل ذلك أننا :
    1- لم نأخذ إلا بروتينا واحدا فقط : علمًا أن البكتريا الواحدة يكون فيها ما لا يقل عن 2000 بروتين !! وأن الخلية الحية الواحدة - مثل الخلية البشرية - يتواجد فيها 200,000 بروتين !
    2- أننا حسبنا احتمالات بروتين متوسط الطول ! يتكون من 500 حمض أميني فقط !

    ولذلك عندما قام روبرت شابيرو Robert Shapiro (أستاذ الكيمياء بجامعة نيويورك وأحد الخبراء في مجال الحمض النووي) بحساب احتمال التكون الصدفي لعدد 2000 بروتين من الموجودين في خلية بكتيرية واحدة فقط , فقد جاءت نتيجة احتمالاته كالتالي :
    (1 إلى 10 أس 40.000) ..!
    وهو رقم مهول جدا وأكثر من الأول بشكل خرافي !!!.. حيث نضع أمام الرقم 1 : أربعين ألف صفر !!!..
    المصدر :
    Robert Shapiro, Origins: A Sceptics Guide to the Creation of Life on Earth, New York, Summit Books, 1986. p.127

    وقد أدلى تشاندرا ويكراماسنغي (أستاذ الرياضيات التطبيقية والفلك بالكلية الجامعية في كارديف - ويلز) بالتعقيب الآتي :
    " تتجسد احتمالية التكوين العفوي للحياة من مادة غير حية : من احتمال واحد ضمن احتمالات عدد مكون من الرقم 1 : وبعده 40.000 صفر !!... وهو رقم كبير بما يكفي لـ : دفن دارون ونظرية التطور بأكملها !.. وإذا لم تكن بدايات الحياة عشوائية , فلا بد أنها قد نتجت عن عقل هادف " !!..
    المصدر :
    Fred Hoyle, Chandra Wickramasinghe, Evolution from Space, New York, Simon & Schuster, 1984, p. 148
    ---------------



    توقيع عبد الرحمن العجمي

  14. #32
    مشرف عام
    رقم العضوية : 36
    تاريخ التسجيل : Oct 2010
    المشاركات : 1,349
    التقييم: 125
    الجنـس : ذكر
    والآن نختم مع المفاجأة الكبرى - بالإضافة إلى كل ما سبق ! - وهي :

    هل تتذكرون شكل وطريقة تجميع الأحماض الأمينية لتكوين سلسلة البروتين أو الإنزيم ؟



    أن كل بروتين من البروتينات الموجودة في الكائنات الحية وخلاياها : فإن سلسلته الطويلة من الأحماض الأمينية تلتف على نفسها في شكل طيات ونتوءات في الفراغ الثلاثي الأبعاد 3D لتعطي لكل بروتين شكلا مجسمًا خاصًا به : ويتلاءم تمامًا تمامًا مع وظيفته في داخا الخلايا وفي أجسام الكائنات الحية وما سيتحد به من مواد وعناصر ومركبات ومناطق نشطة !
    فالواقع أكثر تعقيدا من الصورة التوضيحية البسيطة السابقة !!..

    الصورة التالية توضح سلسلة البروتين قبل الإلتفاف والطي لتأخذ الشكل المجسم الثلاثي الأبعاد الخاص به وكما في الصورة التالية كمثال !


    فهذا بحث مُراجع علميًا (بير ريفيو Peer-Reviewed) يُبين استحالة وجود أي تفسير لكيفية تطور " طيات " البروتين التي تكفل له وظيفته بشكل محوري !!
    The Case Against a Darwinian Origin of Protein Folds
    وهو بحث علمي للدكتور Douglas D. Axe نشر بموقع bio-complexity .
    المصدر :
    http://bio-complexity.org/.../main/article/view/BIO-C.2010.1

    وهذا رابط تفصيل ورقة البحث العلمية The Case Against a Darwinian Origin of Protein Folds
    https://www.google.com/url?sa=t&rct=j&q&esrc=s&source=web...

    وهذه دراسة علمية أخرى تثبت استحالة تطور الأنزيمات من بعضها البعض كذلك - والإنزيمات هي بروتينات وظيفية - :
    The Evolutionary Accessibility of New Enzymes Functions: A Case Study from the Biotin Pathway
    المصدر :
    http://bio-complexity.org/.../main/article/view/BIO-C.2011.1

    وهي دراسة علمية (وتجريبية مثبتة) عام 2011 للعالمين Ann K. Gauger, Douglas D. Axe وتثبت فيها استحالة تطور أو تحول وظائف الأنزيمات المنتمية لنفس المجموعة !!

    حيث الأنزيمات المتماثلة هي تلك البروتينات المتقاربة في الشكل الثلاثي الأبعاد 3D وفي صيغة الأحماض الأمينية : وقد كان التطوريون يدعون أن كل مجموعة أنزيمات قد تحولت من بعضها البعض بالتدريج نظرا للتشابه في التسلسل والهندسية عندها !!.. ولكن بعد محاولة المحاكاة والتجريب : ثبت بطلان هذا الزعم تمامًا !!.. وأنه يلزم على الأقل 7 نيوكليوتيدات يجب أن تتطفر لتكوين أبسط تغيير صغير قد يؤدي لتحول الأنزيم بشكل جزئي لوظيفة جديدة !!
    ومن هنا كانت المفاجأة التي أثبتتها هذه الدراسة وهي :
    أن هذا فاشل مخبريًا ومستحيل واقعيًا تمامًا !!
    وذلك لأن احتمال أن تتطفر كل هذه النكليوتيدات معًا لإعطاء كل هذه الوظائف الجديدة : فإنه يتطلب وقتا وزمنا يفوقان عمر الحياة على الأرض نفسه !! كل ذلك ونحن نتحدث فقط عن تحول أنزيم لأنزيم آخر مماثل وقريب له شكلا وباختلاف وظيفي طفيف !! وليس عن تكون أنزيم مختلف كليا أصلا !!


    الصور المرفقة الصور المرفقة  
    توقيع عبد الرحمن العجمي

  15. #33
    مشرف عام
    رقم العضوية : 36
    تاريخ التسجيل : Oct 2010
    المشاركات : 1,349
    التقييم: 125
    الجنـس : ذكر
    خلاصة هذا الفصل :
    أن العاقل والذي يستخدم فطرته المنطقية التي وهبها الله تعالى له , كان يغنيه الخوض في تفاصيل تلك الاحتمالات المستحيلة : إذا نظر فقط لاستحالة ظهور وعي للذرات والجزيئات التي يتكون منها الحمض النووي والبروتينات والذي نشأ عنه لغة تشفيرية كاملة تحمل معاني وجمل ذات مغزى : يستحيل أن تنتج عن أو تفهمها المادة الصماء إلا إذا آمنا بهداية الله تعالى لها لتسلك كل تلك السلوكيات المعجزة والتصرفات الفريدة المبهرة !
    فنحن لو لدينا جملة واحدة بسيطة من 3 كلمات كل كلمة من 3 أو أربع حروف - مثل كودونات الحمض الوراثي - : لكان اختلاف حرف واحد فيها يغير المعنى المفهوم تمامًا !
    عض الكلب القط
    عض الكل القط !!
    عض القلب القط !!!
    عض الكلب القطب !!!
    وهكذا .......................
    فكيف ظهرت هذه اللغة ومعانيها التي من المفترض أن تسبق حروفها ثم ... كيف ظهر بالتطور النظام الذي يصلح أخطاء الحروف ؟؟ ولماذا يجعله التطور يصلحها أصلا إذا كان وجود هذه الأخطاء هو المحرك الأساسي للطفرات العشوائية كما يزعم التطوريون ؟!
    توقيع عبد الرحمن العجمي

  16. #34
    مشرف عام
    رقم العضوية : 36
    تاريخ التسجيل : Oct 2010
    المشاركات : 1,349
    التقييم: 125
    الجنـس : ذكر
    الفصل_الرابع_استحالة_وجود_طفرات_تخلق_عضوا_أو_كائن_ جديد

    بعدما رأينا في الفصل السابق الاستحالة النظرية والاحتمالية لتكوين بروتين واحد أو خلية حية صدفة , ففي هذا الفصل سنتطرق إلى أحد أعمدة نظرية التطور في آلياتها المعتمدة لدى كل المؤمنين به ألا وهي الطفرات العشوائية .
    وهي تلك الأخطاء التي تقع أثناء نسخ أو تضاعف الحمض النووي داخل النواة بسبب مؤثرات خارجية على جسم الكائن أو خلاياه التناسلية مثل الحرارة الشديدة أو الإشعاع أو بعض المؤثرات الكيماوية والأدوية , حيث إما أن تتبدل أجزاء كاملة من الكروموسومات أو تتكرر أو يتم فقدها أو في جينات النمو والضبط والتحكم , أو تتبدل قاعدة نيتروجينية من قواعده الأربعة (atgc) أو أكثر .. وكل ذلك يظهر في صورة تشوهات الجنين الجسدية والوظيفية .


    وذلك لأن الحمض النووي هو مثل الجهاز المُحكم – كالتلفاز مثلا أو المذياع أو الساعة - : ويستحيل أن يتخيل عاقل أن صدمة لهذا الجهاز سوف يقع بسببها شيء نافع له أو تضيف له وظائف جديدة – مشغل اسطوانات ليزر مثلا !! -

    ومشكلة الطفرات بالنسبة للتطور المفترض تتلخص في 4 معضلات رئيسية :
    1)) أن الطفرات نادرة الحدوث وتقع أثناء نسخ , وهي تقوم بعمل تغييرات في الشريط الوراثي بعشوائية , وذلك يضر نظامه الدقيق ولا ينفعه !! وهو يحذف أو يبدل ولكنه أبدا لن يضيف أي معلومات أو جينات جديدة للكائن !
    2)) أن الطفرات تحدث بسهولة في الأجزاء الأضعف ترابطا (at) ذات الرابطتين الهيدروجينيتين والتي تمثل الـ dna غير الحامل للجينات الوراثية أصلا والتي تكون محمولة غالبا على الأجزاء (gc) الأقوى ذات الثلاث روابط هيدروجينية !!
    3)) أن الانتخاب الطبيعي المزعوم في التطور , وفي الوقت الذي كان من المفترض أن يشجع ويحافظ على أي سبيل للاستكثار من وقوع تلك الطفرات وأخطاءها , نفاجأ بوجود نظام بالغ الدقة والنظام لـ (تصحيح) أخطاء الحمض النووي أثناء النسخ أو التضاعف أولا بأول بأقصى إمكانية متاحة !!!
    4)) وجود تشابهات في جينات أعضاء ووظائف كائنات متباعدة تماما في سلاسل التطور لا تفسير له إلى اليوم !! وذلك لأنه يستحيل أن تتطابق نفس عشوائية الطفرات المزعومة في الوقوع في أكثر من كائن في أكثر من مكان وفي أكثر من زمان على شجرة التطور !!!

    وسوف نتعرض لكل واحدة من تلك المعضلات الآن ...



    توقيع عبد الرحمن العجمي

  17. #35
    مشرف عام
    رقم العضوية : 36
    تاريخ التسجيل : Oct 2010
    المشاركات : 1,349
    التقييم: 125
    الجنـس : ذكر
    1)) بالنسبة لندرة وقوع الطفرات وأنها ضارة ولا تضيف أي معلومات جينية جديدة .

    فهذا ما اعترف به العلماء المختصون بالفعل – سواء من التطوريين أنفسهم أو غيرهم ممن ينتقد التطور - !
    حيث يقول العالم رانغانثان مثلا :
    "إن الطفرات صغيرة وعشوائية وضارة !!.. وهي تتسم بندرة حدوثها ، وتتمثل أفضل الاحتمالات في كونها غير مؤثرة !.. وتلمح هذه السمات الأربع إلى أن الطفرات لا يمكن أن تؤدي إلى أي تقدم على صعيد التطور !! إن حدوث تغير عشوائي في كائن حي يتسم بقدر عال من التخصص ، إما أن يكون غير مؤثر أو ضاراً ، ذلك أن التغير العشوائي في ساعة اليد مثلا لا يمكن أن يُحسن أداء الساعة ، بل أغلب الظن أن هذا التغير سيضرّ بها أو لن يؤثر فيها على أحسن تقدير .. والزلزال لا يُحسن المدينة : بل يجلب لها الدمار" !!..
    المصدر :
    B. G. Ranganathan, Origins?, Pennsylvania: The Banner Of Truth Trust, 1988

    ويُعلق عالم التطور وَرن ويفر على التقرير الصادر عن لجنة التأثيرات الجينية للأشعة الذرية (والتي شُكلت لدراسة الطفرات التي يمكن أن تكون قد نتجت عن الأسلحة النووية المستخدمة في الحرب العالمية الثانية) قائلاً :
    "سيتحير الكثيرون من حقيقة أن كل الجينات المعروفة تقريباً التي أصابتها طفرة هي عبارة عن جينات ضارة !! فالناس يظنون أن الطفرات تشكل جزءاً ضرورياً من عملية التطور ، فكيف يمكن أن ينتج تأثير جيد (أي التطور إلى شكل أعلى من أشكال الحياة) من طفرات كلها ضارة تقريبا ؟" !!..
    المصدر :
    Warren Weaver, "Genetic Effects of Atomic Radiation", Science, Vol 123, June 29, 1956, p. 1159

    بل وقد عمد العلماء إلى دراسة مئات الطفرات عن طريق اللجوء إلى عشرات التجارب الحرارية والإشعاعية والكيميائية على حشرات ذبابة الفاكهة (لقصر دورة حياتها وأجيالها) : فلم يخرجوا بطفرة واحدة مفيدة أو أضافت إلى الحشرة عضوا لم يكن فيها من قبل أو وظيفة جديدة – لأن كل ذلك سيتطلب وجود شيفرات وراثية لكل صفة بكل دقة وإحكام كما نرى في خلق الله تعالى ! - يقول عالم الوراثة التطوري غوردون تايلور :
    " من بين آلاف التجارب الرامية إلى إنتاج ذباب الفاكهة التي تم إجراؤها في جميع أنحاء العالم لأكثر من خمسين سنة : فلم يلاحظ أحدٌ أبداً ظهور نوع جديد متميز !!.. أو حتى إنزيم جديد " !!..
    المصدر :
    Gordon R. Taylor, The Great Evolution Mystery, New York: Harper & Row, 1983, p. 48

    الاســـم:	10301502_639983339423023_273170051735621892_n.jpg
المشاهدات: 264
الحجـــم:	24.9 كيلوبايت
    ويقول العالم مايكل بيتمان :
    " لقد قام مورغان وغولدشميدت ومولر وغيرهم من علماء الوراثة بتعريض أجيال من ذباب الفاكهة لظروف قاسية من الحرارة، والبرودة، والإضاءة، والظلام، والمعالجة بالمواد الكيماوية والإشعاع. فنتج عن ذلك كله جميع أنواع الطفرات، ولكنها كانت كلها تقريباً تافهة أو مؤكدة الضرر !! فهل هذا هو التطور الذي صنعه الإنسان ؟ في الواقع لا ، لأنه لا يوجد غير عدد قليل من الوحوش التي صنعها علماء الوراثة كان بإمكانه أن يصمد خارج القوارير الذي أنتج فيها !! وفي الواقع ، إن هذه الطفرات إما أن يكون مصيرها الموت، أو العقم، أو العودة إلى طبيعتها الأصلية" !!..
    المصدر :
    Michael Pitman, Adam and Evolution, London: River Publishing, 1984, p. 70



    توقيع عبد الرحمن العجمي

  18. #36
    مشرف عام
    رقم العضوية : 36
    تاريخ التسجيل : Oct 2010
    المشاركات : 1,349
    التقييم: 125
    الجنـس : ذكر
    كل ذلك : فضلا عن اعتراف المختصين كذلك بأن كل كائن حي له تركيب جزيئي متباين في أساسه ولا يدعم فكرة التطور والأسلاف المشتركة مُطلقا !! يقول الدكتور مايكل دانتون :
    " إن كل نوع من الأحياء يُعَد - على المستوى الجزيئي- فريداً ووحيداً وغير مرتبط بوسطاء.. ومن ثَم فقد عجزت الجزيئات -شأنها شأن المتحجرات- عن تقديم الوسطاء الذين يبحث عنهم علماء الأحياء من دعاة التطور منذ زمن طويل.. فعلى المستوى الجزيئي : لا يوجد كائن هو جد مشترك أعلى، أو كائن بدائي أو راقٍ مقارنة بأقربائه !! ولا يكاد يوجد شك في أنه لو كان هذا الدليل الجزيئي متاحاً قبل قرن من اليوم , فربما لم تكن فكرة التطور العضوي لتجد أي قبول على الإطلاق" !!..
    المصدر :
    Michael Denton. Evolution: A Theory in Crisis. London: Burnett Books, 1985, pp. 290-91

    بل وحتى المثال الشهير الذي يُكرره التطوريون عن أن هناك طفرات مفيدة – وهو مقاومة البكتريا لبعض المضادات الحيوية – فقد وجد العلماء أن ذلك له سببين , وأن كل منهما لا يعد دليلا أبدا على التطور بالطفرات أو ظهور طفرات تضيف إلى المحتوى الجيني أية صفات جديدة كما يدعيه المتطورون ! والسببان هما :
    1- ظهور طفرة (غير مقصودة) تفقد فيها البكتريا بيانات وراثية ينعدم معها مفعول المضاد الحيوي .
    2- نقل جينات المقاومة الموجودة فعليا في بعض الجراثيم إلى البكتيريا .

    فبالنسبة للسبب الأول , فلو نظرنا إلى حالة طفرة البكتريا لمقاومة مضاد الستربتومايسين Streptomycin : فالمختصون يعرفون أن ربط تلك الطفرة بالتطور – أي أنها أضافت معلومات جديدة - هو مجرد تزوير للحقائق !! وذلك لأن تلك الطفرة التي وقعت في البكتريا : كانت خللاً في جين تكوين جسم الريبوسوم بها – وهو الجسم الذي عن طريقه سيؤثر المضاد الحيوي في البكتريا ليقضي عليها - ! إذن : الخطأ الذي وقع هنا كخلل في الحمض النووي : لم يضف في الحقيقة أي شيئ جديد إلى الجينات كما يصوره التطوريون للعوام وغير المختصين !! وإنما كان عبارة عن خطأ في نسخ قاعدة نيتروجينية واحدة فقط : هو الذي أدى إلى تغيير في جسم الريبوسوم الذي كان من المفترض أن يتعلق به المضاد الحيوي !!

    يشرح ذلك عالم الفيزياء الحيوية سبتنر فيقول :
    " يستطيع الكائن المجهري أحيانا أن يكتسب مقاومة ضد المضاد الحيوي من خلال الاستبدال العشوائي لنكليوتيد nucleotide وحيد... فالستربتومايسين Streptomycinمثلا الذي اكتشفه سِلمان واكسمان Selman Waksman وألبرت شاتز Albert Schatz وتم الإعلان عنه لأول مرة في سنة 1944م : هو مضاد حيوي تستطيع البكتيريا أن تقاومه بتلك الطريقة . ولكن على الرغم من أن الطفرة التي تخضع لها البكتيريا أثناء العملية تفيد الكائن المجهري في وجود الستربتومايسين ، فإنها لا تصلح لأن تكون نموذجا أوليا لنوع الطفرات التي تحتاجها النظرية الداروينية الجديدة !! ذلك أن نوع الطفرة التي تمنح مقاومة ضد الستربتومايسين يتضح في الريبوسوم ويقوم بحل تكافئه الجزيئي مع جزيء المضاد الحيوي" !!..
    المصدر :
    Dr. Lee Spetner, “Lee Spetner/Edward Max Dialogue: Continuing an exchange with Dr. Edward E. Max,”


    الصور المرفقة الصور المرفقة  
    توقيع عبد الرحمن العجمي

صفحة 2 من 6 الأولىالأولى 1234 ... الأخيرةالأخيرة

معلومات الموضوع

الأعضاء الذين يشاهدون هذا الموضوع

الذين يشاهدون الموضوع الآن: 1 (0 من الأعضاء و 1 زائر)

| الكتب بالعربي | Man after Death | An Hour with Ghosts | The Universe and the Quran | The Conflict between the Torah and the Quran | الخلاف بين التوراة و القرآن   | الكون والقرآن | اسلام   | المتشابه من القرآن | تفسير القرآن الكريم    | ساعة قضيتها مع الأرواح | الأنسان بعد الموت | الرد على الملحدين | موقع الهدى للقران الكريم    | محمد علي حسن الحلي حياته ومؤلفاته